|
Sunday, April 27, 2003
Wow! It fits me to a T! Especially the part about "will kill anything to look good!" LOL! Tip from chipstah!
Here's an excellent piece by Paul Greenberg called Sound familiar? CNN: President Truman, now that it's become clear that the occupation of Germany and Japan will be far more challenging than our military victory . HST: You ever been in the service, son? You have any idea how many good men gave their lives so you could stand up here and tell me how easy the war was compared to how hard the peace is going to be? Any of you people have a serious question? Click on the link for the rest...
Anyone who thinks they can control the Internet received an object lesson during the past week. It all started when Madonna literally lent her voice to a popular antipiracy technique. Warner Music Group had audio files purporting to be her new songs uploaded onto peer-to-peer file-sharing services. Anyone who downloaded the decoys, however, heard nothing but the pop star swearing at them. But since then, the pithy profanity has taken on a life of its own. Some observers thought Madonna was smart to fight piracy with its own tools. Others perceived a thrown gauntlet -- hackers soon defaced Madonna's Web site with an equally profane retort along with several downloadable files of the then-unreleased songs. From TheHollywoodReporter.com
Here's an Extract from the Wall Street Journal That Has Me Reaching for a Tire Iron-- Figuratively Speaking The U.S. government is structuring Iraq's vast oil industry much like a corporation, with a chief executive and a management team vetted by American officials who would answer to a multinational board of advisers. Okay so far. The team's task will be huge. An Iraqi national oil company pumping three million barrels a day -- about what was produced before the war to topple Saddam Hussein -- would rival the size of Mexico's Pemex, and exceed the production of the world's largest publicly traded corporation, Exxon Mobil Corp., which pumps about 2.5 million barrels daily. If Iraq eventually produces the six million barrels a day that experts believe is possible, it would rank second to Saudi Arabia's Saudi Aramco state oil company. The money garnered from oil exports -- millions of dollars each day -- would initially be used to restore Iraq's oil fields and shipping ports and for the reconstruction of the country, which has been battered by American bombs and artillery fire. The new team and part of the advisory board are expected to be announced next week. The structure, at least initially, will take the place of the traditional ministry system, with the chief executive performing virtually the same role as the former oil minister, according to government officials, industry experts and former Iraqi oil officials familiar with the plan. This is a narrative device known as "foreshadowing," and I think you can see where it's headed. The chief executive also would represent Iraq at meetings of the Organization of Petroleum Exporting Countries, just as the former oil minister did. Philip J. Carroll, former chief executive of Shell Oil Co., the U.S. arm of Royal Dutch/Shell Group, will be chairman of the board, working closely with an Iraqi vice chairman. That position is expected to be filled by Fadhil Othman, who led Iraq's oil-marketing group before Mr. Hussein assumed power 24 years ago, though the final team and their titles are still being negotiated. Ready for the Zinger? The American-style structure and the appointments may rankle those who believe that the U.S. is wielding too much unilateral power over the occupied nation. It also could irk Iraqi oil-ministry officials who already are back at work trying to get the country's massive oil fields running again. The U.S. is counting on those officials' expertise to run the nuts and bolts of the oil operations. (Wall Street Journal) "Rankle" and "irk" are likely understatements, but why should we care about the delicate feeling of, " . . . those who believe that the U.S. is wielding too much unilateral power over the occupied nation." How about using some of that oil revenue from sales to "those" countries other than the U.S. (several come to mind) to pay for the cost of this war and our subsequent nation-building?
At a high school in prosperous Newton, Massachusetts, it’s “To B GLAD Day”—or, less delicately, Transgender, Bisexual, Gay, Lesbian Awareness Day. An advocacy session for students and teachers features three self-styled transgendered individuals—a member of the senior class and two recent graduates. One of the transgenders, born female, announces that “he” had been taking hormones for 16 months. “Right now I am a 14-year-old boy going through puberty and a 55-year-old woman going through menopause,” she complains. “I am probably the moodiest person in the world.” A second panelist declares herself an “androgyne in between both genders of society.” She adds, “Gender is just a bunch of stereotypes from society, but I am completely personal, and my gender is fluid.” Click the link for the rest...
There is such an easy, accessible quality to the molecule. The man in the street can understand it. A protein just looks a mess, a ball of knitting wool, a haystack without a needle. But DNA has simplicity. It is iconic; it is the snake in the Garden of Eden, tempting man to the knowledge of Good and Evil. It is spiral staircase, a twisted ladder leading upwards to heaven or downwards to the pit of materialism. And it has a message, those mysterious fricatives and plosives in decipherable juxtaposition: TTCATCTTTACTTATTACGAGGCAAGAAGT We love codes. There are those who have found and deciphered codes in the Bible. Others (or maybe these are the same people) have descried significant shapes—faces, star maps—on the surface of Mars. Still others read crop circles or receive messages from UFOs. The slightly more normal among us create working replicas of the Enigma cipher machine or solve the Times crossword in five minutes. And here, in DNA, we have the code of life. No wonder that those who decipher it are viewed as priests reading the runes. Click on the link for the whole article..... Killing and Decapitating Your Wife and Then Lying About it is Wrong Last week, a man was arrested in California because the police think he killed his wife and decapitated her and then lied about it, and I feel that this kind of behavior is very, very wrong and must stop immediately. Just because someone might be angry at his wife does not give him the right to run around killing her. How would you feel if somebody tried to kill you for no reason? That's exactly my point. You wouldn't like it at all! Well, now that we've got our new domain I'd really like to switch over from Blogger to MT. Problem is, I don't have a clue where to begin. I suppose I could read the pages and pages of documentation on how to set up MT but it occurred to me that a much better idea is to beg for help! Anyone out there who wants to help a couple of sexy Republic chicks get switched over to MT? I found something very suspicious over at Frank's blog. First, I read this. Then I read this. It seems to me like he's deliberately trying to confuse us. To what end you ask? Well, I'm not quite sure yet. But I'm working on some theories. I'll let you know what I come up with.
Here's the deal y'all. I want to interview Lori, ya know so we can all get to know her a little better. But I'm just stuck on what to ask her. Then I thought, why don't I ask our readers to come up with the questions? That'd be cool! So, come up with some good questions ya hear? They don't have to be relevant to anything at all either. Just don't think I'm gonna ask her anything too personal OK? Just cuz they're my rules, and you gotta live by them. So there.
1. Throw out nonessential numbers. This includes age, weight and height. 2. Keep only cheerful friends. The grouches pull you down. 3. Keep learning. Learn more about the computer, crafts, gardening, whatever 4. Enjoy the simple things. 5. Laugh often, long and loud. Laugh until you gasp for breath. 6. The tears happen. Endure, grieve, and move on. 7. Surround yourself with what you love, whether it's family, pets, keepsakes, 8. Cherish your health: If it is good, preserve it. If it is unstable, improve it. 9. Don't take guilt trips. 10. Tell the people you love that you love them, at every opportunity. AND ALWAYS REMEMBER: Life is not measured by the number of breaths we take, Be sure to check out the post that talks about French kids who are downloading Osama Bin Laden's picture to their cell phones! Ugh!
Yuck. While I was out of my office (which is right off of the kids' playroom) my son apparently sprayed some (over-the-counter) topical anesthetic (I have it in my office cuz I tend to get real itchy and it makes me stop itching) into my glass of water. Yuck. I took a big swig of my water and it tasted horrible and next thing you know my tongue is totally numb. It reminded me of some times many many years ago when I wasn't so conservative, if you know what I mean.
A. "My other bed is a Rolls-Royce." O.J. says he'd like to be a news commentator for actor Robert Blake's murder Thanks much for the tip D-man!
President Bush: "I did. I talked to Laura a lot during this period of time. She’s been a steady source of strength and inspiration and love. You know, any time there’s war and a lot of action, a lot of movement of troops and equipment, people are — there’s going to be death. And it’s the hardest aspect of this job, frankly, is to know that those lives were lost because of orders I gave. On the other hand, I firmly believe, and history will prove, that decisions that I made and the actions that our country took will make the world more peaceful, help secure the United States. And, as importantly, give the Iraqi people freedom, let them be free — free from the clutches of one of the most barbaric regimes in the history of mankind." Read the rest of the transcript here. Last night was a real neat show as well. All of the audience were service men and women and Jay had an Army chef on - fun show!
Maripat: Hey girl! How are ya!
If you ask me this is just the "trendy" thing to say. I also think it has just become a habit to say and they do not really understand or have any real meaning of what is behind those words. Could it be that people say it because NO ONE really supported the troops during the Viet Nam war and they are making up for that? My Father is a decorated Viet Nam vet and served not one but two voluntary tours there. When he came home, there were no parades, no flags waving, no thank yours, no crowds, no cheers - he was simply greeted by his wife and toddler son. Our troops came home to protestors who spat on them, beat them up, and called them baby killers. So have people said "I support the troops" to cover their asses because if they did not say it they would be totally booed and frowned upon or do they really and truly mean what they are saying? It is just because it is the "Politically Correct" thing to say? Let's look at this for a minute..."I don't support the war but I support the troops." If you support the troops and they support the war, then aren't you supporting the war? Yes, the men and women of the Armed Forces are doing their job and following orders - but I don't see a draft, didn't they volunteer and didn't they take an oath? Don't the troops themselves support their own missions? If you care to challenge me on that one, I challenge you to poll real American troops and ask them. "I don't support the President of the United States, but I support the troops." Well the troops work for and support their Commander in Chief - so if you support the troops aren't you in fact supporting the President? So again when these libbys say "But I support the troops" just what are they backing this up with? Are the rich celebrities volunteering to give concerts, or guest appearances to the troops for free? What about to the bases here in the States? Do these folks go to Veteran's hospitals? Write the troops? Visit with and help out military families? How about volunteering to work with military organizations or donating hours to help keep up the military cemeteries? Or how about just walking up to a service member, shaking their hand and just saying thank you? And my biggest question, what about doing some supporting during peacetime????? Why are they just supporting just with a statement from their mouths and why only during wartime??? Arnold Schwarzenegger just visited the hospital where we are housing wounded soldiers to show support and thank them for their service. Right before the war started, Bruce Willis called the President and offered to enlist and fight with the troops. (many celebrities did actually enlist during WWII) The Goo Goo Dolls were giving free concerts to military bases worldwide three years ago during PEACETIME! I can site many more examples of this but what about all these loud mouth liberals? Basically they just say "But I support our troops" as if to get the approval of Americans and be politically correct. A quote from Rob Lowe - "You know, the best way you can support your troops is to support their Commander in Chief." Well said my friend. What are you DOING to support the troops?
If you haven't been reading his comments, the D-man is . . . well . . . sort of an aspiring curmudgeon in residence. Remember the old guy who used to chase you off his lawn? That's the D-man. But without the initiative to get out of his rocking chair or so he claims. Maripat and I are not buying this "old guy" stuff. So, along with that tablespoonful of vinegar he takes every morning, he'll be blogging along with us next week. *applause* *cheers* *girls screaming* The D-man was kind enough to send us a picture! And for all the ladies out there, he really does wear a uniform! *sighs* New Yorkers Prefer Bush Over Hillary Clinton in 2004 You might be surprised.
We hear a lot today about how we shouldn't lay blame for the terrorism going on. I mean, we aren't to blame the Saudi's, the Yemeni's, or the Palestinians. Yasar Arafat is without guilt, the Arab street is misunderstood, and about the only people who seem to have any real guilt in this whole thing is us. You can blame the west in general, and America in particular. See, we provoked them. It is all our fault. If you were to spell it correctly, you would spell it DESPERATE! (Thanks Bill) I'm sure this is gonna go over well with the NASCAR crowd! I was tired of looking at those ho's
"We strive for perfection but when you're typing that fast, there are occasional mistakes. We regret the error." --ABC's CATHIE LEVINE after a closed caption for an ABC News' Tuesday broadcast said Federal Reserve Chairman ALAN GREENSPAN was hospitalized for "an enlarged prostitute" instead of an enlarged prostate, quoted in The Washington Post. "He should be so lucky." --Greenspan's wife, NBC correspondent ANDREA MITCHELL, reacting to the "enlarged prostitute" in the Post.
Wow! Go there. Now.
There's a picture that needs captioning down yonder! I wanna see some action!
N. Korea: U.S. Leading Region Toward War BEIJING--North Korea accused the United States of leading the region toward war Thursday in an apparent attempt by the communist nation to increase pressure on negotiators holding a second day of talks on its nuclear programs.
I have absolutely NO DESIRE to learn how to pee standing up!
Teacher's Aide Contesting One-Year Suspension for Wearing Cross to School I am SO SICK AND TIRED of liberals!!!!!!!!!! LONDON (Reuters) - U.S. pop superstar Madonna, one of music's richest performers, has attacked her fellow Americans for being obsessed with the "wrong values" such as getting rich and looking good. "She's just a big ho!" -- Maripat (R-CO)
Do a google search on Right We Are We come up first! That just made my day.
10 Things that Acidman Doesn't Understand: here's two of them: 4. Vegetarians. There is not another animal on the face of the planet that has canine teeth and does not eat meat. Why do vegans deny what Mother Nature meant for them to be and somehow feel BETTER ABOUT THEMSELVES for being unnatural idiots? Notice to vegans: Give me a steak and stick that tofu up your ass. 5. "Peace Protesters" who throw things at people, riot in the street and set places on fire. How do you protest for PEACE by acting like a war-like savage? Click here to read the other 8.
This week's picture was kindly submitted by Don. Thanks Don! So, have at it! Give us a caption!
posted by ~Maripat~ More Bloggy Linkage Jaboobie & Two Hard Boiled Eggs Since this is the first time I've made a post referring to all of our newest links, please leave me a message if you think I've forgotten you!
I've thought about this and thought about this. I'm gonna lay out my position for everyone to read on this issue. I'm a faithful Catholic. I do not believe in cafeteria Catholicism, where a person picks and chooses which teachings of the Church they're going to believe in. I believe that the Church's traditions and teachings are part and parcel of being a Catholic. If you don't 'believe' in the sanctity of life and therefore call yourself 'pro-choice' then I'm gonna say that you're not really a Catholic. There's a lot of issues out there like that that Catholics think are debatable. Guess what? They're not. Abortion is a grave sin. Priests are not allowed to marry. Women are not allowed to be ordained as priests. The Pope is the head of the Catholic Church - it's not a democracy. Don't like it? Don't wanna play by the rules? Then don't call yourself a Catholic. Period. As for the homosexuality issue - the Catholic Church does NOT say that BEING homosexual is a sin. They say that sex outside of marriage is a sin - doesn't matter if you're gay or straight. If a man and woman have sex outside of marriage - it's a sin. If two men or two women have sex (obviously outside of marriage, since the Church will only marry a man and a woman) - it's a sin. The Church does not take the stance that a homosexual can "choose" to become straight. It's my understanding that the Catholic Church sees homosexuality as a cross to bear in a person's life. Just as we all have crosses to bear. I don't think one is seen as more horrible than another. I certainly have my own cross to bear and I am constantly dropping my cross so to speak. Yes, I do sin, much much more than I care to admit, although I must do so (admit my sins) in the Sacrament of Reconciliation in order to "make things right" with my God. So is the sin of sex out of marriage (gay or straight) worse than the sins I commit? Man is not to say. Only God knows. I'm not going to make that judgment because I certainly don't know. My younger brother is gay. I can tell you with my full understanding that he did not choose to be gay. That is how God made him. I'm pretty sure if he could have some say in the matter, he would have chosen not to be gay (although I certainly can't speak for him). I know he would have loved to have had children. He would make a wonderful father. But, that's not his course in life. John has made a lifetime partnership with Chris, and they are a funny, faithful, loving couple who happen to have dozens and dozens of friends (both gay and straight, I might add), because they are such good people. And to tell you the truth, I think that's what matters. These two men are good people, doing the best they can with their lives and sharing their happiness and love for each other and for life with everyone around them. I am proud of my brother and the man he has grown into. If you read this John and Chris, I love you both.
TROOPS DIG UP WITCHES' BREW OF CHEMICALS April 22, 2003 -- WASHINGTON - An Iraqi scientist has led U.S. forces to a secret new trove of ingredients and equipment to make chemical weapons - the most promising discovery to date in the search for Saddam's banned weapons, it was revealed yesterday.
but maybe someone can explain this to me, cuz I just don't GET IT. Let's see, the U.S. liberates the Shiite muslims from evil murderous Saddam Hussein. HUH? Did I miss something here?
Watcher of Weasels Inoperable Terran Drumwaster's Rants Peoria Pundit Thinkling's Weblog And let's not forget Jay Solo's Verbosity and A Little More to the Right posted by ~Maripat~ Yes, it's true! Lori and I are gonna be moving to our own domain in the very near future and Lori has put together a new pinup for the festive occasion! Betcha can't wait can you?
 
|
Quote Contact Us
Both Right Chicks!
Spend
Your Money On These Folks
Here
is a list of celebrities who are either registered Republicans or who
support the President. Our money will be spent on the movies,
DVD's, and CD's these folks make. Boycotts Real Time With Bill Maher Show (Click on the contact us link at the bottom of the HBO website and tell them to take this assclown off the air)
Our Hero of the Week
Dale Petroskey - The National Baseball Hall of Fame and Museum is a very special place - a national treasure - and my responsibility is to protect it. Politics has no place in The Hall of Fame. There was a chance of politics being injected into The Hall during these sensitive times, and I made a decision to not take that chance."
Jackass of the Week
Tim Robbins - "Our ability to disagree, and our inherent right to question our leaders and criticize their actions define who we are. To allow those rights to be taken away out of fear, to punish people for their beliefs, to limit access in the news media to differing opinions is to acknowledge our democracy's defeat."
Favorite Posts Middle East TV Guide French Travel Advisory Mike Gallagher Terrorist Quiz An American... Military Rules for Non-Military Personnel The Average Military Man
Support the Prez
For The Boys Why not support our troops like we do? Just click on the graphic and say thank you to our boys!
For The Girls We just love having a little patriotic eye candy for ourselves! Presenting one of our pin ups of the boys. Tee Hee...
V - For Victory!!
Fun Merchandise Hollywood Halfwits has some great merchandise you can order - just click on the ad.
Other
Blogs & Links
Tag Us
Archived Posts Can't get enough? Need to see everything we have posted?
Link To Us Grab one of our logos for your webpage and link it to this site.
Looking for our recent referrer's list? You'll find it all the way at the bottom of the page.
~blog design by Lori & Maripat~ ~Right We Are graphics by Lori~ ~WWII Art by Alberto Vargas~ |
